si:ch211-173o4.2

Ensembl ID:
ENSDARG00000078864
ZFIN ID:
ZDB-GENE-081105-61
Description:
si:ch211-173o4.2 isoform 2 [Source:RefSeq peptide;Acc:NP_001121728]
Human Orthologues:
CIT, LATS2
Human Descriptions:
citron (rho-interacting, serine/threonine kinase 21) [Source:HGNC Symbol;Acc:1985]
LATS, large tumor suppressor, homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:6515]
Mouse Orthologues:
Cit, Lats2
Mouse Descriptions:
citron Gene [Source:MGI Symbol;Acc:MGI:105313]
large tumor suppressor 2 Gene [Source:MGI Symbol;Acc:MGI:1354386]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38734 Nonsense Mutation detected in F1 DNA During 2017
sa7627 Missense Mutation detected in F1 DNA During 2017
sa38735 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34612 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38734
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110996   None 1078 None 10
ENSDART00000111899 Nonsense 286 1140 5 9
ENSDART00000113352 Nonsense 286 1140 3 7
ENSDART00000139620 Nonsense 286 1140 5 9
Genomic Location (Zv9):
Chromosome 9 (position 22329427)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21485213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGATACCCTAGTGGGATTGACCAGGCCATGATGGGGTACAGTGTGTCT[G/T]GACCACCCATGCAAATCCAGTCTCAGCCCTCAGGAGGGCCTGGAGCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7627
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110996 Missense 584 1078 6 10
ENSDART00000111899 Missense 646 1140 5 9
ENSDART00000113352 Missense 646 1140 3 7
ENSDART00000139620 Missense 646 1140 5 9
Genomic Location (Zv9):
Chromosome 9 (position 22330508)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21486294
KASP Assay ID:
554-4070.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGAGTCTCGTATTAAGAGTTATTCTCCATTTGCCTTTAAGTTCTACA[T/A]GGAGCAACATGTGGAGAATGTGATGAAGACATACCAGCAGAAACTTAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38735
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110996 Essential Splice Site 611 1078 6 10
ENSDART00000111899 Essential Splice Site 673 1140 5 9
ENSDART00000113352 Essential Splice Site 673 1140 3 7
ENSDART00000139620 Essential Splice Site 673 1140 5 9
Genomic Location (Zv9):
Chromosome 9 (position 22330591)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21486377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGCAGAAACTTAATCGCAGAATGCAGCTGGAGCAAGAGATGTCCAAG[G/T]TAAGCTATGCTGGAACTGTTTATCACAAAGAACACCGTTTACTTTATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110996 Essential Splice Site 866 1078 8 10
ENSDART00000111899 Essential Splice Site 928 1140 7 9
ENSDART00000113352 Essential Splice Site 928 1140 5 7
ENSDART00000139620 Essential Splice Site 928 1140 7 9
Genomic Location (Zv9):
Chromosome 9 (position 22331616)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21487402
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGTGGGCACCCCTAACTACATTGCCCCTGAGGTGCTTTTGCGCAAAG[G/A]TAAGAATATTCACATAGTCACTCGGAAGTACAAGGACATTACAAAGAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link