ASCC3 (1 of 2)

Ensembl ID:
ENSDARG00000078863
Description:
activating signal cointegrator 1 complex subunit 3 [Source:HGNC Symbol;Acc:18697]
Human Orthologue:
ASCC3
Human Description:
activating signal cointegrator 1 complex subunit 3 [Source:HGNC Symbol;Acc:18697]
Mouse Orthologue:
Ascc3
Mouse Description:
activating signal cointegrator 1 complex subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1925237]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12811 Nonsense Available for shipment Available now
sa3946 Nonsense Mutation detected in F1 DNA During 2014
sa7238 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12811
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114325 Nonsense 408 761 8 16
Genomic Location:
Chromosome 16 (position 2501864)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCAAAAACGGTCAGAGTAGTAGGACTGTCCACSGCGCTGGCTAATGCA[C/T]GAGATCTAGCCGACTGGCTGGGCATCGGACAGGTTAGAAAGACCACTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114325 Nonsense 502 761 10 16
Genomic Location:
Chromosome 16 (position 2505200)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTCATTGCCTTCCTGGCYACTGAAGAYGACCCCAAACAGTGGCTCCAC[C/T]AGGACGAGAGAGAGGTCAGATACAGTATCATCCTCAACTCCCTCATTACNT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114325 Nonsense 629 761 13 16
Genomic Location:
Chromosome 16 (position 2515647)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTATCCTTGTGCACGACATCAAGAAGGACTTTTATAAGAAGTTCCTGTA[C/G]GAGCCGTTCCCTGTGGAGTCTAGGTGTGTACAGAGCCATAAATCTCCCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/okhj39io