ENSDARG00000078854

Ensembl ID:
ENSDARG00000078854
Human Orthologue:
TUSC3
Human Description:
tumor suppressor candidate 3 [Source:HGNC Symbol;Acc:30242]
Mouse Orthologue:
Tusc3
Mouse Description:
tumor suppressor candidate 3 Gene [Source:MGI Symbol;Acc:MGI:1933134]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1726 Nonsense Available for shipment Available now
sa19456 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1726
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054707 Nonsense 36 125 1 3
Genomic Location:
Chromosome 1 (position 14908759)
KASP Assay ID:
554-1672.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAAGAGAGCGGACACATTTGACCTTCAGCGGATCGGCTTTGCCTCTGAG[C/T]AACTGGCCAAGTGGATYGCAGACCGTACTGATGTGCAGGTACTGTATGTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa19456
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054707 Nonsense 57 125 2 3
Genomic Location:
Chromosome 1 (position 14900645)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTCTCTCTCTCTCTGTCCAGATTCGAGTGTTCCGGCCACCCAACTA[C/A]TCTGGCACGATTGCTCTGGCTCTGCTGGTATCTCTGGTTGGCGGTCTCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pacqcgy4