arhgef19

Ensembl ID:
ENSDARG00000078853
ZFIN ID:
ZDB-GENE-090313-243
Human Orthologue:
ARHGEF19
Human Description:
Rho guanine nucleotide exchange factor (GEF) 19 [Source:HGNC Symbol;Acc:26604]
Mouse Orthologue:
Arhgef19
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 19 Gene [Source:MGI Symbol;Acc:MGI:1925912]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9613 Essential Splice Site Available for shipment Available now
sa9879 Essential Splice Site Available for shipment Available now
sa24325 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5047 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113598 Essential Splice Site 535 958 6 15
ENSDART00000133269 Essential Splice Site 76 499 2 11
ENSDART00000113598 Essential Splice Site 535 958 6 15
ENSDART00000133269 Essential Splice Site 76 499 2 11
Genomic Location:
Chromosome 23 (position 24433157)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACCAGCACATTTTGCTAAAAAGTTACATCTTGACTTTTTTTCCCNTTTC[A/G]GGCAAAGTTTGAGTTGRTGACATCAGAGGCCTCATACATACGGAGCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113598 Essential Splice Site 535 958 6 15
ENSDART00000133269 Essential Splice Site 76 499 2 11
ENSDART00000113598 Essential Splice Site 535 958 6 15
ENSDART00000133269 Essential Splice Site 76 499 2 11
Genomic Location:
Chromosome 23 (position 24433157)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACCAGCACATTTTGCTAAAAAGTTACATCTTGACTTTTTTTCCCNTTTC[A/G]GGCAAAGTTTGAGTTGRTGACATCAGAGGCCTCATACATACGGAGCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113598 Essential Splice Site 682 958 8 15
ENSDART00000133269 Essential Splice Site 223 499 4 11
Genomic Location:
Chromosome 23 (position 24432473)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCATTCTTCCTTTTCAAAGAATCACACGCCTCAAAATGCTAGTGGAGG[T/C]ATTTCATCATGCATGTCCAATGCGATAGTGACAGTTATCTGTATCCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113598 Essential Splice Site 907 958 14 15
ENSDART00000133269 Essential Splice Site 448 499 10 11
Genomic Location:
Chromosome 23 (position 24427200)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCTGGAGAAGGCAGACATCCTTCAAGCTGTAACAATTACAAGTGATGG[T/A]GAGGAAAATCATTTCCCTTCTCCTGGCTATTAAACATTATTTCTGCCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/62w89im3