plekhm2

Ensembl ID:
ENSDARG00000078850
ZFIN ID:
ZDB-GENE-081022-169
Description:
pleckstrin homology domain-containing family M member 2 [Source:RefSeq peptide;Acc:NP_001124255]
Human Orthologue:
PLEKHM2
Human Description:
pleckstrin homology domain containing, family M (with RUN domain) member 2 [Source:HGNC Symbol;Acc:2
Mouse Orthologue:
Plekhm2
Mouse Description:
pleckstrin homology domain containing, family M (with RUN domain) member 2 Gene [Source:MGI Symbol;A

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30738 Nonsense Mutation detected in F1 DNA During 2017
sa29925 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30738
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109134 Nonsense 346 994 9 20

The following transcripts of ENSDARG00000078850 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24501363)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24287929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGCCTGGCAAGAAACGACGCGGCAGAGGATCATCAGTGAGTAGTGAA[C/T]AGAACGTCATCTCTCCAGAAGTGACTGATGAATGCCTTCAGATTGTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109134 Nonsense 453 994 9 20

The following transcripts of ENSDARG00000078850 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24501042)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24287608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGGATGGAGCAGAAGAAATTTGCACCGCTCACGACGGGCCCCCCAAT[C/T]AGCAGCCCTTTCGAGAGGATGCTGGCGGTGAACCTCCAGACCCAAGCGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link