B0S6Y4_DANRE

Ensembl ID:
ENSDARG00000078845
Description:
Novel protein similar to human and mouse stereocilin (STRC) [Source:UniProtKB/TrEMBL;Acc:B0S6Y4]
Human Orthologue:
STRC
Human Description:
stereocilin [Source:HGNC Symbol;Acc:16035]
Mouse Orthologue:
Strc
Mouse Description:
stereocilin Gene [Source:MGI Symbol;Acc:MGI:2153816]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12839 Nonsense Available for shipment Available now
sa6074 Nonsense Mutation detected in F1 DNA During 2014
sa3632 Nonsense Mutation detected in F1 DNA During 2014
sa2375 Essential Splice Site F2 line generated During 2014
sa14630 Essential Splice Site Available for shipment Available now
sa20874 Nonsense Mutation detected in F1 DNA During 2014
sa12801 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Nonsense 19 1679 1 31
ENSDART00000111423 None None 1622 None 34
Genomic Location:
Chromosome 7 (position 14800199)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAYTGACAGGAACAGACTCTCAGGATTTCTGTACAACATCTCCATGTACT[T/A]ACAGGAGATGAGCGCCGAGTTAGATGATGGCCAGGGTTTTAGTGACRACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6074
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Nonsense 301 1679 5 31
ENSDART00000111423 Nonsense 270 1622 4 34
Genomic Location:
Chromosome 7 (position 14804847)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTCGCCAGTCCCACATGAACATTCAGGAGCAGACTGATGGAAACCCCT[T/A]SATYTCTGCTGAGATTCTGGAAGCTGCCTGTAACGCCTCKATCCCTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Nonsense 672 1679 7 31
ENSDART00000111423 Nonsense 610 1622 10 34
Genomic Location:
Chromosome 7 (position 14808383)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTGAAGAGAGAGCAAAACTCCACCTTAAAAGAAGATCTTTTGAGCTG[C/A]TTCAGTGTATGTCATGCATTTCAATGCTTCCNTGCCACACTGTAAAACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2375
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 None None 1679 None 31
ENSDART00000111423 Essential Splice Site 675 1622 12 34
Genomic Location:
Chromosome 7 (position 14812586)
KASP Assay ID:
554-3140.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCCATGTTCATCAGAGCTGGGATCAACTTCACGTGGAAACTATACAGG[T/C]AAACAGGACACCTAATTTGTAAAAGTTTTTTCAGCCTGATAATAATCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14630
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Essential Splice Site 1203 1679 20 31
ENSDART00000111423 Essential Splice Site 1146 1622 23 34
Genomic Location:
Chromosome 7 (position 14832881)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGATATTGATCTRAACGACTTGGACCCCTCATTTGCTGCAAGCTTACC[G/A]TGAGATCAATTCTGTGCTACCCACAATCCTTTTGTTTGTTTTGCTCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Nonsense 1234 1679 21 31
ENSDART00000111423 Nonsense 1177 1622 24 34
Genomic Location:
Chromosome 7 (position 14833063)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTACTGGAGCATGTTCGACAACACTTCATTGACTTCCTGCAGCTTCCA[C/T]GACACAAACAAACGGCTCTGGCAGAGAAAGCTATTGACGTACTCGTAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12801
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Essential Splice Site 1390 1679 24 31
ENSDART00000111423 Essential Splice Site 1333 1622 27 34
Genomic Location:
Chromosome 7 (position 14838540)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGGGATTACGAGAAAAGAKGAACGTCCTCATCCACAGGATCATTAAAG[G/T]TCGATGGTGGATGAGACRSGGTGAGTCGTGTTCTGTGTTCATTCACAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k3dj6o3w