TNS1 (2 of 2)

Ensembl ID:
ENSDARG00000078842
Description:
tensin 1 [Source:HGNC Symbol;Acc:11973]
Human Orthologue:
TNS1
Human Description:
tensin 1 [Source:HGNC Symbol;Acc:11973]
Mouse Orthologue:
Tns1
Mouse Description:
tensin 1 Gene [Source:MGI Symbol;Acc:MGI:104552]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20690 Essential Splice Site Available for shipment Available now
sa40676 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33860 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20690
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115118 Essential Splice Site 254 1678 10 33
Genomic Location:
Chromosome 6 (position 22498658)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGAAATGATAATGTATTTGGCAAAGTGTGTTTTGTGTTCATATTCAC[A/T]GTGCTGACCAGGCATTGGACAGGTTTGCGATGAAGCGTTTTTATGAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115118 Essential Splice Site 1094 1678 20 33
Genomic Location:
Chromosome 6 (position 22468488)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGAGGAGATGGAATCAGCTCCTTTTAGTTCTGCCCACGACAATGCTGG[T/C]GAGACACATCTCCTGACACCTGCCATTCCTGTTTCTGTAAGATTTTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115118 Essential Splice Site 1632 1678 33 33
Genomic Location:
Chromosome 6 (position 22452780)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCTGAAAAAAACTGACTCTGATCAATCTTTTTTCTGGTTCACAATGC[A/T]GGCTTTTTGGGTTTGTGGCTCGAAAACAAGGAAGCACGACTGATAATGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)
  • Pulmonary function: Genome-wide association study identifies five loci associated with lung function. (View Study)
  • Pulmonary function (interaction): Genome-wide joint meta-analysis of SNP and SNP-by-smoking interaction identifies novel loci for pulmonary function. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link