LOC100149182

Ensembl ID:
ENSDARG00000078835
Human Orthologue:
ICT1
Human Description:
immature colon carcinoma transcript 1 [Source:HGNC Symbol;Acc:5359]
Mouse Orthologue:
Ict1
Mouse Description:
immature colon carcinoma transcript 1 Gene [Source:MGI Symbol;Acc:MGI:1915822]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17597 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17597
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114732 Splice Site, Nonsense 52 193 1 6
Genomic Location:
Chromosome 12 (position 291964)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYCGGCCCGGGATCGGWTTCTGCCCCGCCAGAGCCGCRRCGCGGAGCACA[C/T]AGGTGAAAACACCGGCGCTGTGCTGATTATTAATGACTGCATTATACTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jnk8z8g6