LOC100329433

Ensembl ID:
ENSDARG00000078831
Human Orthologue:
ABHD5
Human Description:
abhydrolase domain containing 5 [Source:HGNC Symbol;Acc:21396]
Mouse Orthologue:
Abhd5
Mouse Description:
abhydrolase domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1914719]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43354 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114636 Nonsense 194 350 6 10
Genomic Location (Zv9):
Chromosome 19 (position 49952555)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48716497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGTGGAGCCGTGGGGTTTCTCCGCCAGACCCAGTGCCCCGGAGCGCTG[G/A]GTTCCCTTCTGGATTAAAGTGTTCGGAGCTGCTATGAATCCGTTCAACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link