ccdc149a

Ensembl ID:
ENSDARG00000078829
ZFIN ID:
ZDB-GENE-041010-113
Description:
Coiled-coil domain-containing protein 149-A [Source:UniProtKB/Swiss-Prot;Acc:Q5XJA2]
Human Orthologue:
CCDC149
Human Description:
coiled-coil domain containing 149 [Source:HGNC Symbol;Acc:25405]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25378 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7109 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112841 Essential Splice Site 269 463 8 12
ENSDART00000124031 Essential Splice Site 218 352 7 10
Genomic Location:
Chromosome 7 (position 73944580)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCAAGTCCAGTAGCAGATCTCTCACTGGTGTCCTTTCTCCTAAACAAG[G/A]TGCTCAAAAGAAGTGTACTAACAGGAATTGGTTGAAATGTTGTTATTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7109
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112841 Nonsense 441 463 12 12
ENSDART00000124031 None None 352 None 10
Genomic Location:
Chromosome 7 (position 73961252)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGACACGCACTAATGGACAGGTCAGAGCACTTCAGACNAACACACTCATA[T/G]TCACTGAAAGGGGAAGAGAAGCTGATTTGTGACTTGTGTGATGTTGATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a708psxl