si:ch211-158b22.2

Ensembl ID:
ENSDARG00000078825
ZFIN ID:
ZDB-GENE-041014-120
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5PEY7]
Human Orthologue:
BUB1B
Human Description:
budding uninhibited by benzimidazoles 1 homolog beta (yeast) [Source:HGNC Symbol;Acc:1149]
Mouse Orthologue:
Bub1b
Mouse Description:
budding uninhibited by benzimidazoles 1 homolog, beta (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23826 Essential Splice Site Available for shipment Available now
sa29477 Nonsense Mutation detected in F1 DNA During 2017
sa29478 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23826
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114313 Essential Splice Site 175 722 5 20
ENSDART00000138976 Essential Splice Site 207 753 6 21
Genomic Location (Zv9):
Chromosome 20 (position 53840671)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53685450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGATTCAGTAGCAGTTCAGTGAGTCGAGAGGACGATATGAATCAAA[G/A]TGAGTTTCTGCAAGTGATTCGTTTGTTTAATATACATTTTTACATTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114313 Nonsense 411 722 13 20
ENSDART00000138976 Nonsense 442 753 14 21
Genomic Location (Zv9):
Chromosome 20 (position 53850976)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53695755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCAGGAGTGGGGCGGCTCTACTTTTTGTCAGGATCCCACGAAACGCT[T/A]GAATGATGCAGAGAGCAGCCGATCTGCGGAGAGACCAGAGACTGAGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114313 Essential Splice Site 474 722 14 20
ENSDART00000138976 Essential Splice Site 505 753 15 21
Genomic Location (Zv9):
Chromosome 20 (position 53853355)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53698134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGGAAAGCTGGACTTCTGCCTGACACCAGCGATGATCTGCATCTCGG[T/C]ATCCAGAAAACTCCTGCACACATTCAATTCAATCAATGCTTATTTCTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link