sc:d0139

Ensembl ID:
ENSDARG00000078824
ZFIN ID:
ZDB-GENE-080226-7
Description:
hypothetical protein LOC100141487 [Source:RefSeq peptide;Acc:NP_001108576]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9060 Nonsense Mutation detected in F1 DNA During 2017
sa38408 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108686 Nonsense 25 317 2 5
Genomic Location (Zv9):
Chromosome 3 (position 46483196)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48492749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTGTGTTAAATCAATTCTTCTTATTGTGTTTAACAGGTACACTTGCT[A/T]AATGTCCTCTTCAGATCACCCCACAGAGTGTTGTTGTGAAGTATGGKGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108686 Nonsense 94 317 2 5
Genomic Location (Zv9):
Chromosome 3 (position 46483405)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48492958
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAGCTGACAGACTGGGAGATACAGCCACCATTCTGCTACATAAATTA[T/A]GGCAAACAGTGTGAAGTAGCTCTCCCAGTCACTGTTTACAGTGAGTTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link