si:ch211-225k7.5

Ensembl ID:
ENSDARG00000078821
ZFIN ID:
ZDB-GENE-060503-123
Description:
hypothetical protein LOC100002638 [Source:RefSeq peptide;Acc:NP_001093550]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34000 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114124 Nonsense 278 364 4 4
ENSDART00000135106 Nonsense 278 364 5 5
Genomic Location (Zv9):
Chromosome 7 (position 4894578)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 4584891
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCAGACAGAATCATGTGGATCTGGTCTCGGTTCAGTCAGTGGAGATG[C/T]AGCGTCGTGTGATGAACGTGGTTAAACTGGCAACTACTGAGGCGGTGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link