si:dkey-210e6.1

Ensembl ID:
ENSDARG00000078817
ZFIN ID:
ZDB-GENE-081104-369
Description:
Novel protein similar to human and mouse ring finger protein 165 (RNF165) [Source:UniProtKB/TrEMBL;A
Human Orthologue:
RNF165
Human Description:
ring finger protein 165 [Source:HGNC Symbol;Acc:31696]
Mouse Orthologue:
Rnf165
Mouse Description:
ring finger protein 165 Gene [Source:MGI Symbol;Acc:MGI:2444521]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34268 Nonsense Mutation detected in F1 DNA During 2017
sa27119 Nonsense Mutation detected in F1 DNA During 2017
sa21168 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109989 Nonsense 141 347 3 8
ENSDART00000147753 Nonsense 121 327 2 7
Genomic Location (Zv9):
Chromosome 8 (position 763023)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 629533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCTCCAGACAGAACCCTTCCCCATCCACAGACGCTGCGGCCGCCGTA[T/A]GAATATCCTCCATCCATTCACATTCCCCCACCGGTACCACAGCAGCCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109989 Nonsense 217 347 5 8
ENSDART00000147753 Nonsense 197 327 4 7
Genomic Location (Zv9):
Chromosome 8 (position 769051)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 635561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGTTGTTGTTGTGCACAGGTGGTCCATGAGATCAGAAATTATCCATA[T/A]CCTCAGTTACACCTGCTGGCTCTTCAAAGCCTCAGTCCATCTCGGCACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21168
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109989 Essential Splice Site 242 347 5 8
ENSDART00000147753 Essential Splice Site 222 327 4 7
Genomic Location (Zv9):
Chromosome 8 (position 769127)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 635637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCCTCAGTCCATCTCGGCACGCGACGGCAGTGCGGGAGAGTTACGAG[G/A]TGCGGATCATCATCATCATCATCGCTTCAGTTAAAGTACAGCTAATTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link