si:dkey-220o5.1

Ensembl ID:
ENSDARG00000078815
ZFIN ID:
ZDB-GENE-081105-95
Description:
Novel protein similar to vertebrate G protein-coupled receptor kinase 5 (GRK5) [Source:UniProtKB/TrE
Human Orthologues:
GRK4, GRK6
Human Descriptions:
G protein-coupled receptor kinase 4 [Source:HGNC Symbol;Acc:4543]
G protein-coupled receptor kinase 6 [Source:HGNC Symbol;Acc:4545]
Mouse Orthologues:
Grk4, Grk6
Mouse Descriptions:
G protein-coupled receptor kinase 4 Gene [Source:MGI Symbol;Acc:MGI:95801]
G protein-coupled receptor kinase 6 Gene [Source:MGI Symbol;Acc:MGI:1347078]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18662 Nonsense Available for shipment Available now
sa12450 Nonsense Available for shipment Available now
sa27261 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017
sa41284 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18662
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008283 Nonsense 51 575 3 16
ENSDART00000141513 Nonsense 51 576 3 16
Genomic Location (Zv9):
Chromosome 8 (position 46885614)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44661469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAYAGCAGTAYAATTTGAAAAWTTTTCCTTTTGTTTTGTGTGTCAGAA[C/T]GAGACTACGTGTGCCTGWGTGAGAGGCAGCCCATCGGGAGACTTCTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008283 Nonsense 144 575 5 16
ENSDART00000141513 Nonsense 144 576 5 16
Genomic Location (Zv9):
Chromosome 8 (position 46871430)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44675653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAAAGAAAATCTAGAACTGAGCCCCTGCAAGGAAATCTTYAGTGACTG[T/A]CGCAAGTAAGTAARATCWGGACTTCTGTTGCACCTATACACTAATGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27261
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008283 Essential Splice Site 421 575 12 16
ENSDART00000141513 Missense 422 576 12 16
Genomic Location (Zv9):
Chromosome 8 (position 46859790)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44687292
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGTACAGTGACAAGTTTTCAGAAGACACCAAAGCCATCTGCAGGATG[G/A]TGAGGTCACACACACACACAAAACATGCTGGTCAAGTTTTTTTTTGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41284
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008283 Nonsense 433 575 13 16
ENSDART00000141513 Nonsense 434 576 13 16
Genomic Location (Zv9):
Chromosome 8 (position 46856870)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44690212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTTATCCCACAGCTGTTATCCAAAGATCCCAAGCAGAGGCTCGGCTG[T/A]CAGACGGACAGAGCTTCTGGAGTCAAAGCCCATCCTTTCTTCAAGAACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Chronic kidney disease: New loci associated with kidney function and chronic kidney disease. (View Study)
  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)
  • Prothrombin time: Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link