A4QP83_DANRE

Ensembl ID:
ENSDARG00000078814
Description:
LOC100005466 protein [Source:UniProtKB/TrEMBL;Acc:A4QP83]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2300 Nonsense F2 line generated During 2014
sa20657 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20656 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2300
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108656 Nonsense 192 619 6 10
Genomic Location:
Chromosome 6 (position 10619703)
KASP Assay ID:
554-2758.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGGTGCCTAGTTCTAGCTCAAGCGAGMCCTCAAAAAAGGCAGYTGAA[C/T]AGAGTCCACCACCAAAGCCCCACACACCTGCGTCCGAGCCCGATCCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20657
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108656 Essential Splice Site 251 619 8 10
Genomic Location:
Chromosome 6 (position 10617083)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTATTGGTGAATTGTCCTTTATTACCTTAACAATGAACTTTTTCTCC[A/T]GCTGCCTAGTTCTAGCTCAGGCGAGACCTCAAAAAAGGCAGTTGAACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108656 Nonsense 443 619 10 10
Genomic Location:
Chromosome 6 (position 10613012)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCAGACCATAAGCAACACATGATGACCCACACCGGAGAGAAACCATA[T/G]AAATGCAATGTGTGCGACAAAGCATTTGCGTCCGCTTCAAACCTGAAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x65esgsk