gas2l1

Ensembl ID:
ENSDARG00000078803
ZFIN IDs:
ZDB-GENE-030131-3723, ZDB-GENE-070705-38
Description:
Novel protein similar to human and mouse growth arrest-specific 2 like 1 (GAS2L1) [Source:UniProtKB/
Human Orthologue:
GAS2L1
Human Description:
growth arrest-specific 2 like 1 [Source:HGNC Symbol;Acc:16955]
Mouse Orthologue:
Gas2l1
Mouse Description:
growth arrest-specific 2 like 1 Gene [Source:MGI Symbol;Acc:MGI:1926176]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa488 Essential Splice Site Confirmed mutation in F2 line During 2014
sa17066 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa488
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112287 Essential Splice Site 276 576 5 10
ENSDART00000144635 Essential Splice Site 301 313 4 4
Genomic Location:
Chromosome 5 (position 26495425)
KASP Assay ID:
554-0340.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTTATAAATTTTAAAAGGGTTGTCTGACATACTTCTATCTTTGACA[G/A]CTCACCGGTATCAGCAGGCAAAAGCGAGTGGCCAGGCTCCTCACAGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17066
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112287 Nonsense 308 576 5 10
ENSDART00000144635 None None 313 None 4
Genomic Location:
Chromosome 5 (position 26495328)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGAGCTCMAGCACTCATTCTTCCCGCTCAACAAGCCCAGGACCTCACT[G/A]GCGTAATGAGGGCATCGCACCCTACAAAATRMCCGACAGACGCTCGTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/st5627yy