LOC100151141

Ensembl ID:
ENSDARG00000078802
Human Orthologue:
RNF111
Human Description:
ring finger protein 111 [Source:HGNC Symbol;Acc:17384]
Mouse Orthologue:
Rnf111
Mouse Description:
ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20978 Nonsense Available for shipment Available now
sa7068 Nonsense Mutation detected in F1 DNA During 2014
sa20977 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111626 Nonsense 582 958 9 16
Genomic Location:
Chromosome 7 (position 31910798)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGACCCCTGCTGTCCAGGCTCTGCCTCCCGGCCTCCCGTTTACGTTTCC[C/T]AGGCTGCACCTGGACCTAGCCAGCAAACTGTGGCCGACTCATTCAGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7068
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111626 Nonsense 772 958 11 16
Genomic Location:
Chromosome 7 (position 31905844)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCATAGAATGCACCCTAATTACGGTCACGGACATCACATTCACGTCCCA[C/T]AAACCATGTCATCCCTCCCTCGACAGTCTGACCAGAGGACAACATGGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111626 Essential Splice Site 827 958 13 16
Genomic Location:
Chromosome 7 (position 31904817)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTAGCCCACTTTATACCATCACTGATTTTTATGTCTCTGTTTTTCTC[A/C]GCACACTGGCTCAATGCCTGAGGTGACATATCCACATATCCGCTATATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qc3gkpou