LOC798497

Ensembl ID:
ENSDARG00000078801
Human Orthologue:
C4orf44
Human Description:
chromosome 4 open reading frame 44 [Source:HGNC Symbol;Acc:33741]
Mouse Orthologue:
A930005I04Rik
Mouse Description:
RIKEN cDNA A930005I04 gene Gene [Source:MGI Symbol;Acc:MGI:2684990]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2350 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2350
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108938 Nonsense 69 274 1 3
Genomic Location:
Chromosome 7 (position 19768930)
KASP Assay ID:
554-2639.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCTACGAGACCATGGCTAAGCAACTWTACGAATTAACTGGGGAACAG[C/T]GRCACAGAGAGGAGATCAAGATGAAGATTACCAACATGACCTTCCAATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ompl4lma