dennd3a

Ensembl ID:
ENSDARG00000078797
ZFIN ID:
ZDB-GENE-091230-6
Human Orthologue:
DENND3
Human Description:
DENN/MADD domain containing 3 [Source:HGNC Symbol;Acc:29134]
Mouse Orthologue:
Dennd3
Mouse Description:
DENN/MADD domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2146009]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10213 Nonsense Available for shipment Available now
sa39222 Nonsense Mutation detected in F1 DNA During 2017
sa43199 Nonsense Mutation detected in F1 DNA During 2017
sa8874 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13522 Essential Splice Site Available for shipment Available now
sa43200 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115136 Nonsense 35 1270 2 23
Genomic Location (Zv9):
Chromosome 19 (position 1817932)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1748887
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTCTCTTGCTTTTTAACTTYTCGYACAGGGTAAAGAWGCAGATGTGT[T/A]RGTGGAGGCGGAGGTGCTGCAGGTTCACGCTCCACCGTTTATAACAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115136 Nonsense 164 1270 4 23
Genomic Location (Zv9):
Chromosome 19 (position 1820756)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1751711
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTAATTTGTGTTGTGTTATTGTAGTTCCAGCAAGATAATGTGATTTA[T/A]GCAAACGGCCATCGAACCAACGAACACAAGCGTCTGTACACCACATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43199
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115136 Nonsense 188 1270 4 23
Genomic Location (Zv9):
Chromosome 19 (position 1820828)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1751783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACACAAGCGTCTGTACACCACATTCAGCATATGTGTGATCTCCAAATA[T/G]CCCTATTATAACGCCCTCAGAGACTGCCTGTCCTGGTAAGACTGCTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115136 Essential Splice Site 934 1270 16 23
Genomic Location (Zv9):
Chromosome 19 (position 1844048)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1774634
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTACGCTGCYACYAAACTGGCTTACTTTGACAAGATGAAGTCTGAGGG[T/A]GTGTTTCACTCAGCACGCGCTGTTTAAATCAACAGGAATTAAGTCTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13522
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115136 Essential Splice Site 970 1270 17 23
Genomic Location (Zv9):
Chromosome 19 (position 1845008)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1775594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGACCAGACGAGTCCTCAAGCAGTGGACGTKCTGCTCTACACTCCWGG[T/C]GAGTCTCTCAGACACCKCCTCACAGCAAGAACGTCRCTGGTTCTAGTCCK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43200
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115136 Nonsense 1228 1270 23 23
Genomic Location (Zv9):
Chromosome 19 (position 1859325)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1789911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTCACAGACAGACGAGTGCGAGGGAAGATCTACATAGTAAACACGGAC[C/T]GATATACAGTGGAGAAAGAGCTGCAGGCCCACGCCGACGCCGTTCAGACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link