si:ch211-172j10.2

Ensembl ID:
ENSDARG00000078789
ZFIN ID:
ZDB-GENE-090312-89
Description:
transmembrane protein 184C [Source:RefSeq peptide;Acc:NP_001139068]
Human Orthologue:
TMEM184C
Human Description:
transmembrane protein 184C [Source:HGNC Symbol;Acc:25587]
Mouse Orthologue:
Tmem184c
Mouse Description:
transmembrane protein 184C Gene [Source:MGI Symbol;Acc:MGI:2384562]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39644 Nonsense Mutation detected in F1 DNA During 2017
sa38277 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111566 Nonsense 115 447 4 10

The following transcripts of ENSDARG00000078789 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 36433520)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35993378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAGTATCCCAACATTGCCATCTATGTAGACACATGTAGAGAGTGCTA[C/A]GAGGCCTATGTCATTTACAACTTTATGATCTTCCTTCTCAACTACCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111566 Nonsense 312 447 9 10

The following transcripts of ENSDARG00000078789 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 36443244)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36003102
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGGAAATGTTTTTGGCAGCCATTGCCCATCACTTCAGCTTCACTTA[C/A]AAGCCCTACATACAGGAAGCAGAGGAAGGTTCCTGCTTTGATTCCTTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link