mga

Ensembl ID:
ENSDARG00000078784
ZFIN ID:
ZDB-GENE-030603-1
Description:
MAX-interacting protein [Source:RefSeq peptide;Acc:NP_001164210]
Human Orthologue:
TBX6
Human Description:
T-box 6 [Source:HGNC Symbol;Acc:11605]
Mouse Orthologue:
Tbx6
Mouse Description:
T-box 6 Gene [Source:MGI Symbol;Acc:MGI:102539]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36333 Nonsense Mutation detected in F1 DNA During 2016
sa9048 Nonsense Mutation detected in F1 DNA During 2016
sa865 Nonsense Available for shipment Available now
sa3993 Nonsense Mutation detected in F1 DNA During 2016
sa39148 Nonsense Mutation detected in F1 DNA During 2016
sa18203 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110593 Nonsense 174 2735 1 23
ENSDART00000137469 Nonsense 174 2648 2 24
ENSDART00000144408   None 23 None 2

The following transcripts of ENSDARG00000078784 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 10029871)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCAGATATAAATGGAGTGGCAAAGGATGGGAACCCAATGGGAAGGCT[G/T]AGCCTCATATTTCACGGTTGTTTGTACACCCAGAATCCCCTGCTAGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110593 Nonsense 525 2735 2 23
ENSDART00000137469 Nonsense 525 2648 3 24
ENSDART00000144408   None 23 None 2
ENSDART00000110593 Nonsense 525 2735 2 23
ENSDART00000137469 Nonsense 525 2648 3 24
ENSDART00000144408   None 23 None 2

The following transcripts of ENSDARG00000078784 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 10028435)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGAGACCTGAACGTGTGCCCCTGCCTCTCCTCGCTAAGTTTCTAAAA[C/T]AGAGAAGACCTATTTTGCCCAAACCTGTCTCTCACAGCTCACTCTCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110593 Nonsense 525 2735 2 23
ENSDART00000137469 Nonsense 525 2648 3 24
ENSDART00000144408   None 23 None 2
ENSDART00000110593 Nonsense 525 2735 2 23
ENSDART00000137469 Nonsense 525 2648 3 24
ENSDART00000144408   None 23 None 2

The following transcripts of ENSDARG00000078784 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 10028435)
KASP Assay ID:
554-0767.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGAGACCTGAACGTGTGCCCCTGCCTCTCCTCGCTAAGTTTCTAAAA[C/T]AGAGAAGACCTATTTTGCCCAAACCTGTCTCTCACAGCTCACTCTCAGAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa3993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110593 Nonsense 1121 2735 7 23
ENSDART00000137469 Nonsense 1084 2648 7 24
ENSDART00000144408   None 23 None 2

The following transcripts of ENSDARG00000078784 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 10025773)
KASP Assay ID:
2261-0678.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGACAGAGCAACCTCTCTGCATTTTGTAGTGACATGTTGGATGAGTA[C/A]CTGGCCAGTGAGGGCAAATTGATTGATGAACGAGCTGCCAGCTTATCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110593 Nonsense 1913 2735 15 23
ENSDART00000137469 Nonsense 1979 2648 16 24
ENSDART00000144408   None 23 None 2

The following transcripts of ENSDARG00000078784 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 10018811)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTGAGCAGTCTTCCTTCTACCCTTAAAGTTGTCCAGGGTTTTCTGGGA[C/T]AGTCTGGCACTTGCACATTAAGAATTCTCCCACCAACTACTTCAACTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18203
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110593 Nonsense 2406 2735 21 23
ENSDART00000137469 Nonsense 2472 2648 22 24
ENSDART00000144408   None 23 None 2

The following transcripts of ENSDARG00000078784 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 10015611)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATAACCATAAACAACTCACTTCAACCGATTGGCATCACCTCAGTTGGA[C/T]AACAATCATCTACACCAGGTTTGTCTCCAAACAGGTTAACAATTCTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link