si:ch211-260b17.8

Ensembl ID:
ENSDARG00000078778
ZFIN ID:
ZDB-GENE-030131-1783
Human Orthologue:
LRCH1
Human Description:
leucine-rich repeats and calponin homology (CH) domain containing 1 [Source:HGNC Symbol;Acc:20309]
Mouse Orthologue:
Lrch1
Mouse Description:
leucine-rich repeats and calponin homology (CH) domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17804 Essential Splice Site Available for shipment Available now
sa41424 Nonsense Mutation detected in F1 DNA During 2017
sa15164 Nonsense Available for shipment Available now
sa41425 Nonsense Mutation detected in F1 DNA During 2017
sa34651 Nonsense Mutation detected in F1 DNA During 2017
sa18420 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108629 Essential Splice Site 292 693 6 20
ENSDART00000135074 Essential Splice Site 292 655 6 19
Genomic Location (Zv9):
Chromosome 9 (position 26165915)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25321701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTTCCTGWCACTGACCGCCTCAGCTTGACACGACCCAGCAATGGGAGG[T/G]CAGTACAAACCGCAAAATAAAATAATTTTTTTCAGAAACTKAACAAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108629 Nonsense 371 693 9 20
ENSDART00000135074 Nonsense 371 655 9 19
Genomic Location (Zv9):
Chromosome 9 (position 26172494)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25328280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTAGGAGACAGAAGTTCTTCTGAATCTCTGAAGGATCACCTGAGTTA[T/A]CGAGATTCTGCCCTTAGTTCACCATTCGTAAACTATATTAAAGTAAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15164
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108629 Nonsense 403 693 10 20
ENSDART00000135074 Nonsense 403 655 10 19
Genomic Location (Zv9):
Chromosome 9 (position 26174139)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25329925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGGTGCTGACTTCGACGAGCCCCTCAGGAWAGAGGAAGACACTAATTG[G/A]GYTTCAGAACRAACGTATGTTTATCTTCTTATTTTTAWCATCAGATCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108629 Nonsense 407 693 10 20
ENSDART00000135074 Nonsense 407 655 10 19
Genomic Location (Zv9):
Chromosome 9 (position 26174149)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25329935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTCGACGAGCCCCTCAGGATAGAGGAAGACACTAATTGGGTTTCAGAA[C/T]AAACGTATGTTTATCTTCTTATTTTTATCATCAGATCCTTTTCTTCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108629 Nonsense 521 693 16 20
ENSDART00000135074   None 655 None 19
Genomic Location (Zv9):
Chromosome 9 (position 26182834)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25338620
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCATCTACTGTAGCTTCACCCTCTGTGCCGTGCTCGACTCCGCCCTG[T/A]CCCCTCCCCCTCACACAGGCCCCGCCCACCGATAGAGACACGCCCCCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108629 Essential Splice Site 584 693 17 20
ENSDART00000135074 Essential Splice Site 546 655 16 19
Genomic Location (Zv9):
Chromosome 9 (position 26187456)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 25343242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGGAGCAGCTAAGAGAAGAGCTGGAGCTCACAGAGMAACTTCGAGAGG[T/C]RCACAGACATTCTCATATNAAAAAAGATGTGTGTTTTAAATATATTAGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link