LOC100331813

Ensembl ID:
ENSDARG00000078775
Human Orthologue:
RASA2
Human Description:
RAS p21 protein activator 2 [Source:HGNC Symbol;Acc:9872]
Mouse Orthologue:
Rasa2
Mouse Description:
RAS p21 protein activator 2 Gene [Source:MGI Symbol;Acc:MGI:2149960]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36713 Nonsense Mutation detected in F1 DNA During 2016
sa30705 Nonsense Mutation detected in F1 DNA During 2016
sa10677 Nonsense Available for shipment Available now
sa43161 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36713
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114993 Nonsense 218 823 8 24
Genomic Location (Zv9):
Chromosome 18 (position 39434028)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41146420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAATGTTTCTGAAGGTAACAAGGTCAAGCAGTTACAAAGGGAGGTCA[C/T]AGTTTCATGTAGAGGAGGAGGACATAGAGAAACTGGAGATCAAGTGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114993 Nonsense 366 823 11 24
Genomic Location (Zv9):
Chromosome 18 (position 39420550)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41132942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACAACCGCCTGCTGCCCTTTCTCACTGCTGTTGCTGCACTGGAGCTG[G/T]AGAATACACAGTTCAGTATCACAGTTACATAGTTAAAAAAAAAATCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10677
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114993 Nonsense 448 823 14 24
Genomic Location (Zv9):
Chromosome 18 (position 39417234)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41129626
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TNNAGGAGAATCTGCARGGTTATGTRCAGAAGGTTTTTACATCTATAACA[C/T]ARTCCAGCTCTAGCTGTCCCCCCCTCATGTGTGAYGTCTTCAGGTCACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114993 Nonsense 740 823 22 24
Genomic Location (Zv9):
Chromosome 18 (position 39395324)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41107791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGTTGGCTAATATTCAACTGGATATCGACTGTGACCGGGAAACAGAG[C/T]GAATCTTCTCCTTCTTCTCCACCTACCGCTCCAGACTACAGAAGATGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link