si:ch73-60l17.1

Ensembl ID:
ENSDARG00000078767
ZFIN ID:
ZDB-GENE-081104-292
Description:
Novel protein similar to vertebrate YEATS domain containing 2 (YEATS2) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
YEATS2
Human Description:
YEATS domain containing 2 [Source:HGNC Symbol;Acc:25489]
Mouse Orthologue:
Yeats2
Mouse Description:
YEATS domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2447762]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19858 Essential Splice Site Available for shipment Available now
sa8716 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19858
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113232 Essential Splice Site 68 1417 2 30
ENSDART00000139137   None 477 None 12
ENSDART00000141605   None 93 None 4
Genomic Location (Zv9):
Chromosome 2 (position 44679196)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44764697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCTTGAGATGAAGAGTAAAGAGCATGAGATTGAGGTCATCGGGCAGG[T/C]AATAGTCGGTTCAACACTCACGTAATTAGTACAGTTTGTTTCTAATCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113232 Nonsense 308 1417 8 30
ENSDART00000139137   None 477 None 12
ENSDART00000141605   None 93 None 4
Genomic Location (Zv9):
Chromosome 2 (position 44689501)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44775002
KASP Assay ID:
2259-2571.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTGATGTCAGTGTTAATCTTCTTTTATTTCTTCTCCATCAGCTTGAC[C/T]GAACATACACAGGTTTGCAGACTTTGGGAGCTGAAACGGTAAGATAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link