FAM82A1

Ensembl ID:
ENSDARG00000078761
Description:
family with sequence similarity 82, member A1 [Source:HGNC Symbol;Acc:26567]
Human Orthologue:
FAM82A1
Human Description:
family with sequence similarity 82, member A1 [Source:HGNC Symbol;Acc:26567]
Mouse Orthologue:
Fam82a1
Mouse Description:
family with sequence similarity 82, member A1 Gene [Source:MGI Symbol;Acc:MGI:2147043]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22369 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17789 Nonsense Available for shipment Available now
sa22368 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111536 Essential Splice Site 141 403 2 11
Genomic Location:
Chromosome 13 (position 42702607)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTAATCTCTCTTTATTTAATCATACTGTACCCTATTCTTTGTTCTGC[A/T]GGTATATAACTGCACTGACTGATTCAGAGGAAGATGAAAGTGATGATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17789
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111536 Nonsense 356 403 9 11
Genomic Location:
Chromosome 13 (position 42689549)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATTCTACAGGCAGAAGAGAWCAGTCCCAAGTACTCCAAATTTAACTA[C/A]GTGTTTTTAGCTAAGGTAATGACTCTTTTGGTTTAACACCTTGACTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111536 Nonsense 374 403 10 11
Genomic Location:
Chromosome 13 (position 42687524)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTTCTTGTCAGTGTTATAAAGACTTAGGCCAGAGGAGTGTTGCTCAA[C/T]AGATGTGTGACGCTGCCTCTACCATAAGCGTCGTGACTAAAGAGGTCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cdhhhffs