cacna2d3

Ensembl ID:
ENSDARG00000078760
ZFIN ID:
ZDB-GENE-030616-133
Description:
Novel protein similar to calcium channel proteins [Source:UniProtKB/TrEMBL;Acc:Q8JFR4]
Human Orthologue:
CACNA2D3
Human Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 3 [Source:HGNC Symbol;Acc:15460]
Mouse Orthologue:
Cacna2d3
Mouse Description:
calcium channel, voltage-dependent, alpha2/delta subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1338890]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21959 Nonsense Mutation detected in F1 DNA During 2014
sa16189 Nonsense Available for shipment Available now
sa16051 Nonsense Available for shipment Available now
sa17764 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002055 Nonsense 225 1095 6 38
Genomic Location:
Chromosome 11 (position 37584204)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCAACCCTCATCTGGCAGTACTTTGGAAGCGCTAAAGGTTTTTTCCGA[C/T]AATACCCAGGTGCGTAACGTGGCATTATGTCAGCGCAGGAATTGATGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16189
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002055 Nonsense 231 1095 7 38
Genomic Location:
Chromosome 11 (position 37583830)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAATTACTATAAATYCTTTACATKATGTGTGTTTTCAGGCGTGAAATG[G/A]TATCCTGACGAACACGGCGTCATTGCATTTGATTGCAGAAACAGAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16051
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002055 Nonsense 697 1095 24 38
Genomic Location:
Chromosome 11 (position 37550324)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTAANTGTCCTCTCCTGCTTGTTGTAGGTGACAGAGAGCTGATTCAG[C/T]AGGTTCTGTTTGATGCTGTGGTCACCGCTCCTGTAGAAGCCTACTGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17764
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002055 Essential Splice Site 902 1095 31 38
Genomic Location:
Chromosome 11 (position 37543117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAAGGAGCCGTCATGAATAAACTGCTTCTGATGGGCTCGTTTAAAAA[G/A]TGAGAGACGCACTGCTCRTATATTAACCTCTTTTTAATGAATTAACCTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q4yxkj5n