si:ch211-1n9.7

Ensembl ID:
ENSDARG00000078759
ZFIN ID:
ZDB-GENE-090313-71
Description:
Novel protein similar to vertebrate DNA replication helicase 2 homolog (Yeast) (DNA2) [Source:UniPro
Human Orthologue:
DNA2
Human Description:
DNA replication helicase 2 homolog (yeast) [Source:HGNC Symbol;Acc:2939]
Mouse Orthologue:
Dna2
Mouse Description:
DNA replication helicase 2 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2443732]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42185 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35475 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35476 Essential Splice Site Mutation detected in F1 DNA During 2017
sa773 Nonsense Confirmed mutation in F2 line During 2017
sa8393 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42185
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109798 Essential Splice Site 13 1378 1 22
ENSDART00000135424 Essential Splice Site 13 237 1 3
ENSDART00000144094   None 1020 None 20
Genomic Location (Zv9):
Chromosome 13 (position 22962251)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22691589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTCACACATGTCTACAATGATGAAGTGCAAATCCAGCCGATCATCT[G/A]TGAGTATTTAAATAAGTTCGTTTGCTGCTATATTGTTAGATGTTTTTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35475
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109798 Essential Splice Site 514 1378 6 22
ENSDART00000135424   None 237 None 3
ENSDART00000144094 Essential Splice Site 160 1020 3 20
Genomic Location (Zv9):
Chromosome 13 (position 22969336)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22698674
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACATTTGCCACGGAGGCCTTAAGAAGCCCCAACTACCTCGGACAAATG[T/A]AAGTACTCTCCTGTAACTGTCAACTCCACCTTTAGTGGCAAACTTGGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109798 Essential Splice Site 674 1378 9 22
ENSDART00000135424   None 237 None 3
ENSDART00000144094 Essential Splice Site 320 1020 6 20
Genomic Location (Zv9):
Chromosome 13 (position 22970292)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22699630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACTGGCAGTCTACATCCTGTTGTGGGCAATCACATGGACAGGAGAGG[T/C]TAGATTTATATAGAGGTTTATACTTGTAAAGGACAGAAATGAAGATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa773
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109798 Nonsense 710 1378 10 22
ENSDART00000135424   None 237 None 3
ENSDART00000144094 Nonsense 356 1020 7 20
Genomic Location (Zv9):
Chromosome 13 (position 22971011)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22700349
KASP Assay ID:
554-0678.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGATGGGAAAAGTCAAATGGCCCAATTGCCTGCCATTGTATCTGACCAG[C/T]AAACTTGCAAATATTGTCCTCAGAAAAGGAACTGTGCAATTTACAACAGG
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Entity Quality Tag
Larval:Day 5
ZFS:0000037
eye
ZFA:0000107

decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
head
ZFA:0001114

malformed
PATO:0000646
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
larval locomotory behavior
GO:0008345

disrupted
PATO:0001507
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076

aplastic
PATO:0001483
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
anterior/posterior axis
BSPO:0000013
increased length
PATO:0000573
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa8393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109798 Nonsense 931 1378 14 22
ENSDART00000135424   None 237 None 3
ENSDART00000144094 Nonsense 577 1020 11 20
Genomic Location (Zv9):
Chromosome 13 (position 22972492)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22701830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRGAATTCAGGCCTCCTCAGTTCATTGACAGCCTCAGCAGTGTTTTGCCA[C/T]GAGATGCCAAGGACATTGTGKCCAACATTCTGAAAGGTGCATTCATACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link