ENSDARG00000078758

Ensembl ID:
ENSDARG00000078758
Human Orthologues:
SCN10A, SCN11A, SCN5A
Human Descriptions:
sodium channel, voltage-gated, type V, alpha subunit [Source:HGNC Symbol;Acc:10593]
sodium channel, voltage-gated, type X, alpha subunit [Source:HGNC Symbol;Acc:10582]
sodium channel, voltage-gated, type XI, alpha subunit [Source:HGNC Symbol;Acc:10583]
Mouse Orthologues:
Scn10a, Scn11a, Scn5a
Mouse Descriptions:
sodium channel, voltage-gated, type V, alpha Gene [Source:MGI Symbol;Acc:MGI:98251]
sodium channel, voltage-gated, type X, alpha Gene [Source:MGI Symbol;Acc:MGI:108029]
sodium channel, voltage-gated, type XI, alpha Gene [Source:MGI Symbol;Acc:MGI:1345149]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10223 Essential Splice Site Available for shipment Available now
sa10300 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10223
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097722 Essential Splice Site 578 1841 15 51
Genomic Location:
Chromosome 24 (position 42796401)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGAGACCGAGCCCTGAGCGCAACCAGCTACATCACTGACGCCATGGAGG[G/A]TGAGAGAGACACACAACACAACACARCACARCACAACACARCACARCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097722 Nonsense 681 1841 17 51
Genomic Location:
Chromosome 24 (position 42819247)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACGGCTGAGATGGTKCTGAAAATCATCGCTCTGGACCCGTATTATTA[C/A]TTTMAGCAGGGCTGGAACATTTTCGACAGTCTGATCGTCAGTCTGAGTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hinrezum