ENSDARG00000078758

Ensembl ID:
ENSDARG00000078758
Human Orthologues:
SCN10A, SCN11A, SCN5A
Human Descriptions:
sodium channel, voltage-gated, type V, alpha subunit [Source:HGNC Symbol;Acc:10593]
sodium channel, voltage-gated, type X, alpha subunit [Source:HGNC Symbol;Acc:10582]
sodium channel, voltage-gated, type XI, alpha subunit [Source:HGNC Symbol;Acc:10583]
Mouse Orthologues:
Scn10a, Scn11a, Scn5a
Mouse Descriptions:
sodium channel, voltage-gated, type V, alpha Gene [Source:MGI Symbol;Acc:MGI:98251]
sodium channel, voltage-gated, type X, alpha Gene [Source:MGI Symbol;Acc:MGI:108029]
sodium channel, voltage-gated, type XI, alpha Gene [Source:MGI Symbol;Acc:MGI:1345149]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39466 Nonsense Mutation detected in F1 DNA During 2016
sa10223 Essential Splice Site Available for shipment Available now
sa10300 Nonsense Available for shipment Available now
sa32502 Essential Splice Site Available for shipment Available now
sa44202 Nonsense Mutation detected in F1 DNA During 2016
sa32503 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39466
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097722 Nonsense 110 1841 2 51
Genomic Location (Zv9):
Chromosome 24 (position 42731601)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40693532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAACAAAGGGAAGGCCATCTTCCGGTTTAGTGCCACGTCTGCACTCTA[T/A]ATTTTTAGCCCTTTTCATCCCATTAGAAGAGCATCAATACGGATTTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10223
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097722 Essential Splice Site 578 1841 15 51
Genomic Location (Zv9):
Chromosome 24 (position 42796401)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40757498
KASP Assay ID:
2261-9158.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGAGACCGAGCCCTGAGCGCAACCAGCTACATCACTGACGCCATGGAGG[G/A]TGAGAGAGACACACAACACAACACARCACARCACAACACARCACARCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097722 Nonsense 681 1841 17 51
Genomic Location (Zv9):
Chromosome 24 (position 42819247)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40780344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACGGCTGAGATGGTKCTGAAAATCATCGCTCTGGACCCGTATTATTA[C/A]TTTMAGCAGGGCTGGAACATTTTCGACAGTCTGATCGTCAGTCTGAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097722 Essential Splice Site 970 1841 29 51
Genomic Location (Zv9):
Chromosome 24 (position 42838493)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40799590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATACATCCTTTCATCAATCCATCTATCGCTTAATCTATTGTTCTTTCC[A/T]TCATTTCATCATTTTATCCATCAATCCATCCACGATTTGTTCTATCTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097722 Nonsense 1731 1841 51 51
Genomic Location (Zv9):
Chromosome 24 (position 42889351)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 41226131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATAAAATCCACTGTTTGGATATTTTATTCGCGTTTACGAAACGCGTGT[T/A]GGGCGAATCGGGAGAAATGGATGCGCTCAAGCAACAAATGGAGGAGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097722 Nonsense 1741 1841 51 51
Genomic Location (Zv9):
Chromosome 24 (position 42889380)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 41226160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCGTTTACGAAACGCGTGTTGGGCGAATCGGGAGAAATGGATGCGCTC[A/T]AGCAACAAATGGAGGAGAAGTTTATGATGGCAAATCCGTCAAAGATTTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link