si:ch211-254e10.2

Ensembl ID:
ENSDARG00000078755
ZFIN ID:
ZDB-GENE-091118-37
Human Orthologue:
RP4-788L13.1
Human Description:
Lipid phosphate phosphatase-related protein type 4 [Source:UniProtKB/Swiss-Prot;Acc:Q7Z2D5]
Mouse Orthologue:
D3Bwg0562e
Mouse Description:
DNA segment, Chr 3, Brigham & Women's Genetics 0562 expressed Gene [Source:MGI Symbol;Acc:MGI:106530

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12785 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12785
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110233 Nonsense 619 746 7 7
ENSDART00000148249   None 358 None 7
Genomic Location (Zv9):
Chromosome 24 (position 30939212)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 30047773
KASP Assay ID:
2261-8882.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGCATGCGCACTCCACAGATGGAAGTGGCTCCTGGACGTGGAAGTCC[C/T]AAAGCAGCTTTAGACAATCATTTGAGCTTAATGACTTGAATCGAGACTCR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link