si:ch1073-280h16.1

Ensembl ID:
ENSDARG00000078752
ZFIN ID:
ZDB-GENE-100922-142
Human Orthologue:
KIAA0226
Human Description:
KIAA0226 [Source:HGNC Symbol;Acc:28991]
Mouse Orthologue:
1700021K19Rik
Mouse Description:
RIKEN cDNA 1700021K19 gene Gene [Source:MGI Symbol;Acc:MGI:1915160]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12122 Nonsense Available for shipment Available now
sa11314 Essential Splice Site Available for shipment Available now
sa24212 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112234 Nonsense 321 914 7 21
ENSDART00000143647 Nonsense 69 599 1 14
Genomic Location (Zv9):
Chromosome 22 (position 38174267)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35312985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGGACTCGGGGCGAYGCCCATACRYCGTTGGCTCCACCTCCACAGCGA[C/T]GATGCTCTYTCTCAGAGKCTCAGAAAGCCACRGGGCGGAGCTCAAGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11314
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112234 Essential Splice Site 492 914 10 21
ENSDART00000143647   None 599 None 14
Genomic Location (Zv9):
Chromosome 22 (position 38182115)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35320833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATACGACGCACACGACTCAAACCAGCAGCCGCCGCCTCCAGTAATCG[T/A]AAGACTCCARATTTTCTGATCKCATTTGGCTGCAAGTTGAGAWGGGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24212
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112234 Nonsense 860 914 20 21
ENSDART00000143647 Nonsense 590 599 14 14
Genomic Location (Zv9):
Chromosome 22 (position 38194219)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35332937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTCATCTGTGAGTTCTGTGGAAACGACAAGGACATCATCTTCCCCTA[C/A]GAGCTCAACAAGTGCCTGCGCTGTGAAGGTCAGCGTGATTCCTCTTACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link