il1rapl1b

Ensembl ID:
ENSDARG00000078740
ZFIN ID:
ZDB-GENE-090109-2
Description:
interleukin-1 receptor accessory protein-like 1-B [Source:RefSeq peptide;Acc:NP_001136054]
Human Orthologue:
IL1RAPL1
Human Description:
interleukin 1 receptor accessory protein-like 1 [Source:HGNC Symbol;Acc:5996]
Mouse Orthologue:
Il1rapl1
Mouse Description:
interleukin 1 receptor accessory protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:2687319]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13388 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112871 Nonsense 429 466 6 6
Genomic Location:
Chromosome 11 (position 46442147)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCCAGCACACGTACTGTAACATCCCTATGAGCCTGCTGARTGGCCAG[C/T]GACCACCGGGCCAACCAGCCCATGGGCAGCAGCAGAGCCTGGAGGAGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a513356e