cnnm2b

Ensembl ID:
ENSDARG00000078733
ZFIN ID:
ZDB-GENE-090311-26
Description:
Novel protein similar to H.sapiens CNNM2, cyclin M2 (CNNM2) [Source:UniProtKB/TrEMBL;Acc:B8JIF2]
Human Orthologue:
CNNM2
Human Description:
cyclin M2 [Source:HGNC Symbol;Acc:103]
Mouse Orthologue:
Cnnm2
Mouse Description:
cyclin M2 Gene [Source:MGI Symbol;Acc:MGI:2151054]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3342 Nonsense Mutation detected in F1 DNA During 2014
sa1438 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa3342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112333 Nonsense 157 807 1 7
Genomic Location:
Chromosome 1 (position 31179741)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTAAACCGCAAGACGTCTGGCACCGTSGAGATAGAGGTCAAACCTCTG[C/T]GAAAGACTGAGCGGAGCAAAGCGTACTACCTGTGCATCGCCACCTCCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1438
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112333 Nonsense 740 807 7 7
Genomic Location:
Chromosome 1 (position 31251344)
KASP Assay ID:
554-1365.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGAGCTTTTGTAAGTTGCCCTGTTCTCTTTGTTTTCAACAGGTAACG[C/T]GACAGCAGTATCARAATGCCGTCATGGCCTCACGCATAGACAAAACCCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/15j7pe29