LOC556241

Ensembl ID:
ENSDARG00000078731
Mouse Orthologues:
Gm4070, Gvin1
Mouse Descriptions:
GTPase, very large interferon inducible 1 Gene [Source:MGI Symbol;Acc:MGI:1921808]
predicted gene 4070 Gene [Source:MGI Symbol;Acc:MGI:3782245]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26940 Nonsense Mutation detected in F1 DNA During 2016
sa34051 Nonsense Mutation detected in F1 DNA During 2016
sa12388 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114919 Nonsense 185 1509 1 1
Genomic Location (Zv9):
Chromosome 7 (position 23102430)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21667615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCAGCATTTCTAAATCTCAGATCTTAAACAAACTGCTTAGCAACCCC[C/T]AACAGTATCATGATACCTTTGTACATCGTGACATGGACTGTGGAGATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114919 Nonsense 481 1509 1 1
Genomic Location (Zv9):
Chromosome 7 (position 23103318)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21668503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGAACCTAGACAATCTCTCCCGAACAAACCTCTCCGACCTCCGAGAG[C/T]AGTACAAAGAAAAGTGTCAGCATTTTTCAGAAAACAAAGAGGAAATCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114919 Nonsense 549 1509 1 1
Genomic Location (Zv9):
Chromosome 7 (position 23103523)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21668708
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACGTCAACAAATGCTCCACTTGCCAAAGTTATGYGCTAAGCTGATGT[T/A]GAATGGTTTYCCACTRGAACTGGTTGATGGAGATGCYTCAAATATTCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link