si:ch211-255f4.4

Ensembl ID:
ENSDARG00000078723
ZFIN IDs:
ZDB-GENE-050208-388, ZDB-GENE-080305-13, ZDB-GENE-080305-13
Description:
hypothetical protein LOC100006445 [Source:RefSeq peptide;Acc:NP_001108543]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43751 Nonsense Mutation detected in F1 DNA During 2017
sa16181 Nonsense Available for shipment Available now
sa7249 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43751
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106601 Nonsense 200 506 4 7
ENSDART00000147547   None 53 None 2
Genomic Location (Zv9):
Chromosome 22 (position 2678511)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1491359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCACATGTGGATCCACACTGGAGAGAAACCGTACAAGTGTTCACAATG[C/A]GACAAGAAATTCTGTAAATTACAAGACCTGAAAACACACAAGAAGATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16181
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106601 Nonsense 377 506 6 7
ENSDART00000147547   None 53 None 2
Genomic Location (Zv9):
Chromosome 22 (position 2679356)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1492204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGAGTGATCCAGAACCCTGCAGAATTAAACAGGAAGASMMTGAAGAA[C/T]AAAYAGGTTGGTGTTTATTCATTAMTCTTCAATAATGTAGCTGAAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106601 Essential Splice Site 379 506 7 7
ENSDART00000147547   None 53 None 2
Genomic Location (Zv9):
Chromosome 22 (position 2681049)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1493897
KASP Assay ID:
554-4865.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCCGTCTGCCACTYAACACTGTCATGTRACTTATTTACTTTATTTGCA[G/A]AGGTGAAGGTGGAGAGTGAAGTACTGTGGGGAATCGAAGATGAGGAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link