sema7a

Ensembl ID:
ENSDARG00000078707
ZFIN ID:
ZDB-GENE-030131-3633
Description:
semaphorin-7A [Source:RefSeq peptide;Acc:NP_001108357]
Human Orthologue:
SEMA7A
Human Description:
semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) [Source:HGNC Symbol;Acc:10741]
Mouse Orthologue:
Sema7a
Mouse Description:
sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A Gene [Source:MGI S

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38090 Nonsense Available for shipment Available now
sa24691 Nonsense Available for shipment Available now
sa44317 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38090
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127274 Nonsense 126 640 4 14
Genomic Location (Zv9):
Chromosome 25 (position 27712218)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26402312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTTTTCAAAACTGCAAATTTGTATGTGGGACAAATGGAGAAGAGCCA[C/T]AGTGCTGGGAACTGGTAAGAGAACTTATTAGTAGTGCAATATTTTTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24691
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127274 Nonsense 212 640 7 14
Genomic Location (Zv9):
Chromosome 25 (position 27713517)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26403611
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCTCCCACACAGAACCTACTTTTATCTCCAGTTTCCTGGCCAAGCGC[A/T]AAAATGACTCCTTGAATGAGAAGATATATGTCCTATTCCGAGAAAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44317
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127274 Nonsense 569 640 14 14
Genomic Location (Zv9):
Chromosome 25 (position 27733218)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26423312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATGCCAGTTATAGATGGGAACACGGGGGCAAAAGCAACCCATGTCAA[C/T]AGACCCAATCGGAATACCTCCTCCTAATCCCAGCTATGACGGCTGAGAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link