A4QP97_DANRE

Ensembl ID:
ENSDARG00000078703
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A4QP97]
Human Orthologue:
ASPH
Human Description:
aspartate beta-hydroxylase [Source:HGNC Symbol;Acc:757]
Mouse Orthologue:
Asph
Mouse Description:
aspartate-beta-hydroxylase Gene [Source:MGI Symbol;Acc:MGI:1914186]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17803 Essential Splice Site Available for shipment Available now
sa2365 Essential Splice Site Available for shipment Available now
hu7910 Essential Splice Site Available for shipment Available now
sa13653 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17803
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114008 Essential Splice Site 61 436 3 13
Genomic Location:
Chromosome 7 (position 59450373)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGCAGAAATWTCCACATAGTCCGAGGTGCAGATACGGTAAAGCACAG[G/A]YAACACATTATCATAAMAGGTTGCAATGCTGATGTGTCTATGKTATATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2365
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114008 Essential Splice Site 61 436 3 13
ENSDART00000114008 Essential Splice Site 61 436 3 13
Genomic Location:
Chromosome 7 (position 59450372)
KASP Assay ID:
554-2396.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCAGAAATTTCCACATAGTCCGAGGTGCAGATACGGTAAAGCACAGG[T/C]AACACATTATCATAAAAGGTTGCAATGCTGATGTGTCTATGTTATATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7910
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114008 Essential Splice Site 61 436 3 13
ENSDART00000114008 Essential Splice Site 61 436 3 13
Genomic Location:
Chromosome 7 (position 59450372)
KASP Assay ID:
554-2396.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCAGAAATWTCCACATAGTCCGAGGTGCAGATACGGTAAAGCACAGG[T/C]AACACATTATCATAAMAGGTTGCAATGCTGATGTGTCTATGTTATRTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13653
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114008 Nonsense 121 436 5 13
Genomic Location:
Chromosome 7 (position 59445167)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AARATTCCAAAWTTACCATGCAGGTCGTACGAGGGGATCTTTAGCWACTT[T/A]GGAGAAGCTAGTCCAGATTTYTCCCGAAGACATCAGCCTTAAGAATGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ag1dxloi