prdm13

Ensembl ID:
ENSDARG00000078701
ZFIN ID:
ZDB-GENE-080616-1
Description:
PR domain containing 13 [Source:UniProtKB/TrEMBL;Acc:A5XCE2]
Human Orthologue:
PRDM13
Human Description:
PR domain containing 13 [Source:HGNC Symbol;Acc:13998]
Mouse Orthologue:
Prdm13
Mouse Description:
PR domain containing 13 Gene [Source:MGI Symbol;Acc:MGI:2448528]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11161 Essential Splice Site Available for shipment Available now
sa16464 Nonsense Available for shipment Available now
sa32101 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11161
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108510 Essential Splice Site 45 615 1 5
ENSDART00000136759 Essential Splice Site 47 308 1 4
Genomic Location (Zv9):
Chromosome 16 (position 35064403)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32795903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGGGAAAGTATGTTTCGGACCGCAAGGAACTTGGAGTAAAAAAGAAG[G/A]TAAGTYCGTTTGATTTATTTCCTTAAAGAAAGGCGTTTTCTTGAAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108510 Nonsense 137 615 4 5
ENSDART00000136759 Nonsense 139 308 4 4
Genomic Location (Zv9):
Chromosome 16 (position 35068317)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32799817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTAATGGTTATGACATTTTGTTTCAGGTGAGGAGCGATACATTTGCTG[G/A]TATTGTTGGAGAATATTCAAATACCCGAACACCTTGAAAGCTCATGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32101
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108510 Nonsense 515 615 4 5
ENSDART00000136759   None 308 4 4
Genomic Location (Zv9):
Chromosome 16 (position 35069451)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32800951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTTGAAGATTCACATGAGGACTCATACAGGCTACAAACCACTCAAATG[C/A]AAAGTGTGCTTCAGGCCTTTTGGCGATCCGAGCAATCTGAACAAACACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link