si:ch73-360o10.1

Ensembl ID:
ENSDARG00000078691
ZFIN ID:
ZDB-GENE-091204-310
Human Orthologue:
GIGYF1
Human Description:
GRB10 interacting GYF protein 1 [Source:HGNC Symbol;Acc:9126]
Mouse Orthologue:
Gigyf1
Mouse Description:
GRB10 interacting GYF protein 1 Gene [Source:MGI Symbol;Acc:MGI:1888677]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41650 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41651 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41650
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109070 Essential Splice Site 334 1007 8 24
ENSDART00000134864   None 240 None 7
Genomic Location (Zv9):
Chromosome 10 (position 22718267)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22548605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAAGAGGAGTGTTGTCAGGAAAAGAAAGACAGCCCTGCTGATAAATG[T/C]AAGAAGTCCATTTCAACTTGCATGATATGATTCTGTATTTTGTGTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109070 Essential Splice Site 431 1007 11 24
ENSDART00000134864   None 240 None 7
Genomic Location (Zv9):
Chromosome 10 (position 22719788)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22550126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTAAAAAGAAGCACAAACTAAACAAAAAAAAAACTTTGTGATTTTAAA[G/T]GAGGCTGAGAAGATGGTTGCGTCCCTGCAAGACACATCTCTTGAAGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link