LOC100330077

Ensembl ID:
ENSDARG00000078685
Human Orthologue:
RUFY1
Human Description:
RUN and FYVE domain containing 1 [Source:HGNC Symbol;Acc:19760]
Mouse Orthologue:
Rufy1
Mouse Description:
RUN and FYVE domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2429762]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9055 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112082 Nonsense 13 697 1 17
Genomic Location:
Chromosome 14 (position 7011253)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGACAGGCAAATATGGCGGACGARGATCCAAACACGAAAGTTGAAAGC[G/T]GAGACGTTCCTGCWAAAGAAGWAGAACCGGAGGTWACGGAAACCGGGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Eating disorders: Genome-wide association analysis of eating disorder-related symptoms, behaviors, and personality traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4hezb01t