LOC100329403

Ensembl ID:
ENSDARG00000078683
Human Orthologue:
RNF14
Human Description:
ring finger protein 14 [Source:HGNC Symbol;Acc:10058]
Mouse Orthologue:
Rnf14
Mouse Description:
ring finger protein 14 Gene [Source:MGI Symbol;Acc:MGI:1929668]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28394 Nonsense Mutation detected in F1 DNA During 2017
sa28395 Nonsense Mutation detected in F1 DNA During 2017
sa30682 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112698 Nonsense 75 423 2 6
Genomic Location (Zv9):
Chromosome 15 (position 3624909)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 4030143
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCCTTTTTGCCGTCCACGATTTTGAGTTTTGAACTACCCACAGACTA[T/A]CCTTCATCATCAGCTCCAGTCTTTACTCTGAGCTCCATATGGCTTTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112698 Nonsense 217 423 3 6
Genomic Location (Zv9):
Chromosome 15 (position 3625507)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 4030741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGCTTTACTGAGAATCTGGGCTCCAGCTTTGTGCTCTTCAATGAGTG[T/A]CAGCATGTGTACTGCAAGACCTGCGTTAGGGATTACTTCGAGATCCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112698 Nonsense 338 423 5 6
Genomic Location (Zv9):
Chromosome 15 (position 3629832)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 4035066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTTAAATGACATTACATTTTTACTCTACAGTACAAGAGGAGAATGAA[C/T]GACACGAAAAGCTTGCAATAATAAGGAAAGAGGATGAAGTGTGGGTGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link