dock7

Ensembl ID:
ENSDARG00000078675
ZFIN ID:
ZDB-GENE-050302-15
Description:
Dock7 protein [Source:UniProtKB/TrEMBL;Acc:Q4QRD5]
Human Orthologue:
DOCK7
Human Description:
dedicator of cytokinesis 7 [Source:HGNC Symbol;Acc:19190]
Mouse Orthologue:
Dock7
Mouse Description:
dedicator of cytokinesis 7 Gene [Source:MGI Symbol;Acc:MGI:1914549]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40719 Nonsense Mutation detected in F1 DNA During 2017
sa40720 Nonsense Mutation detected in F1 DNA During 2017
sa20727 Nonsense Available for shipment Available now
sa16309 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40719
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042134 Nonsense 177 2129 6 49
ENSDART00000065149   None 319 None 8
ENSDART00000124551 Nonsense 177 295 6 9

The following transcripts of ENSDARG00000078675 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 32028694)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32349610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCCTGAATAAAATCAGTGATTGCTGTATGTTACAGGATGATTTGAAA[C/T]GAAGGTCCATGTCAATTGATGACACGCCACGGGGCAGCTGGGCCTGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042134 Nonsense 549 2129 14 49
ENSDART00000065149 Nonsense 155 319 4 8
ENSDART00000124551   None 295 None 9

The following transcripts of ENSDARG00000078675 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 32032257)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32353173
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCCGACAGTCGAGTGCGGCCAACAAAAGAGATCCTGGAGTTCCCTGCC[A/T]GAGACGTTTATGTGCCCAACACCACTTACAGGTACAAAGACCCTTTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20727
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042134 Nonsense 1059 2129 26 49
ENSDART00000065149   None 319 None 8
ENSDART00000124551   None 295 None 9

The following transcripts of ENSDARG00000078675 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 32061180)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32382096
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCACTGCACTGGTTAGCACTATTGCTGGTGACATCGTCTCACGTTTT[C/T]AGAAGGTGAGAACATTGCAACTGCATGAATTCCTTGAGCTGTTTTTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16309
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042134 Nonsense 1811 2129 42 49
ENSDART00000065149   None 319 None 8
ENSDART00000124551   None 295 None 9

The following transcripts of ENSDARG00000078675 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 32081299)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32402215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATTCACGAGGCCAACAGGGATGCTAAGAAGCTTGCCACTATTCATGGT[A/T]AACTTCAGGAAGCCTTTGGCAAAATCGTRCACCAGGTAAATGCTTATGYT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
  • Triglycerides: Genetic variants influencing circulating lipid levels and risk of coronary artery disease. (View Study)
  • Triglycerides: Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts. (View Study)
  • Triglycerides: Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link