TGFBR3

Ensembl ID:
ENSDARG00000078670
Description:
transforming growth factor, beta receptor III [Source:HGNC Symbol;Acc:11774]
Human Orthologue:
TGFBR3
Human Description:
transforming growth factor, beta receptor III [Source:HGNC Symbol;Acc:11774]
Mouse Orthologue:
Tgfbr3
Mouse Description:
transforming growth factor, beta receptor III Gene [Source:MGI Symbol;Acc:MGI:104637]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15029 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15029
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109313 Splice Site, Nonsense 722 848 13 15
Genomic Location:
Chromosome 6 (position 20785508)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGYTTACACCTGGATCTTGTTCTGWYRTTCCTGCTTTTCTCTTTGTAGTG[T/A]ATGTTACCGGATGAAGCCTGCACTTCCCTCAGTATAGAGAGCATCCTACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide association and follow-up replication studies identified ADAMTS18 and TGFBR3 as bone mass candidate genes in different ethnic groups. (View Study)
  • Optic disc parameters: Genome-wide association studies in Asians confirm the involvement of ATOH7 and TGFBR3, and further identify CARD10 as a novel locus influencing optic disc area. (View Study)
  • Type 2 diabetes: Genome-wide association study for type 2 diabetes in Indians identifies a new susceptibility locus at 2q21. (View Study)
  • Vertical cup-disc ratio: A genome-wide association study of optic disc parameters. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/whlo37qk