
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tmem176
- Ensembl ID:
- ENSDARG00000078659
- ZFIN ID:
- ZDB-GENE-080902-2
- Description:
- transmembrane protein 176 [Source:RefSeq peptide;Acc:NP_001139082]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12946 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12946
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000097500 | Essential Splice Site | 79 | 230 | 2 | 7 |
ENSDART00000134464 | Essential Splice Site | 79 | 190 | 2 | 6 |
ENSDART00000137216 | Essential Splice Site | 79 | 141 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 1 (position 45393295)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 44236514 GRCz11 1 44937817 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGCGACAGTGATCCTTAACAGCGGTGTGCCATGGTGGAGTGGTATTATGG[T/A]AATGTTATTTCAGGAMATAATCATTAAATAACAAATTAGGGTCACGGCAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: