tmem176

Ensembl ID:
ENSDARG00000078659
ZFIN ID:
ZDB-GENE-080902-2
Description:
transmembrane protein 176 [Source:RefSeq peptide;Acc:NP_001139082]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12946 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12946
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097500 Essential Splice Site 79 230 2 7
ENSDART00000134464 Essential Splice Site 79 190 2 6
ENSDART00000137216 Essential Splice Site 79 141 2 5
Genomic Location:
Chromosome 1 (position 45393295)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCGACAGTGATCCTTAACAGCGGTGTGCCATGGTGGAGTGGTATTATGG[T/A]AATGTTATTTCAGGAMATAATCATTAAATAACAAATTAGGGTCACGGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3vmu7ro4