LOC100005732

Ensembl ID:
ENSDARG00000078652
Human Orthologue:
ZFYVE1
Human Description:
zinc finger, FYVE domain containing 1 [Source:HGNC Symbol;Acc:13180]
Mouse Orthologue:
Zfyve1
Mouse Description:
zinc finger, FYVE domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3026685]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37052 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23726 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114929 Essential Splice Site 474 791 5 12
Genomic Location (Zv9):
Chromosome 20 (position 28442667)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28513970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGCTGTCGCTATTCAGCCCACTATGATAATCGCATCTACACCTGCAAG[G/A]TAGGTTGTAAACGATGAAATGCATGATCTTCTGACCATACAGCTACACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23726
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114929 Nonsense 508 791 7 12
Genomic Location (Zv9):
Chromosome 20 (position 28443554)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28514857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCTTTATACACATGGACCTGACTGAATAGCTTTTATCTTTGTAGATA[T/A]GTGATTGAGTGTCCAAACTGCTCAGTGATCTATAGAAGTAGGCAATACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link