LOC559036

Ensembl ID:
ENSDARG00000078650
Human Orthologue:
KCNA4
Human Description:
potassium voltage-gated channel, shaker-related subfamily, member 4 [Source:HGNC Symbol;Acc:6222]
Mouse Orthologue:
Kcna4
Mouse Description:
potassium voltage-gated channel, shaker-related subfamily, member 4 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14195 Nonsense Available for shipment Available now
sa20984 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14195
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111055 Nonsense 34 497 1 1
Genomic Location:
Chromosome 7 (position 33932282)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAYGTCCTCAGTCAGGGTATGAAAACGTTTACAATGAGTACGGCTGCTG[C/A]GAGAGAGTTGTCMTCAACGTGTCGGGCTTAAAGTTTGAAACTCAGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20984
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111055 Nonsense 194 497 1 1
Genomic Location:
Chromosome 7 (position 33931804)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCCATAGTCATTTTTTGTTTAGAAACATTGCCAGAATTCAGGGACGAC[A/T]AAGAATTCCTCATCCCAGGTAAAAACTCCACGCAGGCAGACAATGGATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7652oprc