samsn1b

Ensembl ID:
ENSDARG00000078647
ZFIN ID:
ZDB-GENE-041010-135
Description:
SAM domain-containing protein SAMSN-1 [Source:RefSeq peptide;Acc:NP_001006039]
Human Orthologue:
SAMSN1
Human Description:
SAM domain, SH3 domain and nuclear localization signals 1 [Source:HGNC Symbol;Acc:10528]
Mouse Orthologue:
Samsn1
Mouse Description:
SAM domain, SH3 domain and nuclear localization signals, 1 Gene [Source:MGI Symbol;Acc:MGI:1914992]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15266 Nonsense Available for shipment Available now
sa21788 Essential Splice Site Available for shipment Available now
sa27661 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21789 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15266
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110609 Nonsense 293 676 9 16
ENSDART00000112457   None 354 None 8
Genomic Location (Zv9):
Chromosome 10 (position 39781449)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38471420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACACKTCCACGCACACCTGCCACAGGTCAACAGCTGAACAGGTGATGTA[C/A]AACTTTAATTTCACCCTGCCCWGAGACACGGATTGGGACAGATATGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110609 Essential Splice Site 340 676 9 16
ENSDART00000112457   None 354 None 8
Genomic Location (Zv9):
Chromosome 10 (position 39781591)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38471562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACGTGGATCACACACTCTGTCATGGAGCTGGACAAGCCTGATGCGCTG[G/A]TGAGATTCTGGACTTTTCCTTTTAAAATTATTTCCCAAGTGTTGTTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27661
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110609   None 676 None 16
ENSDART00000112457 Essential Splice Site 18 354 1 8
Genomic Location (Zv9):
Chromosome 10 (position 39783933)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38473904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAAGAAAACCATCAAATGCCTCTGATAAATCAAGAAACAAGCCAAAG[G/A]TAAAATATTTATCTATTTTTTAATTAATTAAAACTCTCTGTCCATCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21789
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110609 Nonsense 553 676 14 16
ENSDART00000112457 Nonsense 231 354 6 8
Genomic Location (Zv9):
Chromosome 10 (position 39789177)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38479148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCACACCACAACCGAGGATTCGTGCTCACCGGAGGAGCAGGAGACCT[C/T]GACCCAAAACCCTGCAGGAGCTTCTGGAAAGACTCAATCTGGAGGTGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link