CAMKK2 (2 of 2)

Ensembl ID:
ENSDARG00000078645
Description:
calcium/calmodulin-dependent protein kinase kinase 2, beta [Source:HGNC Symbol;Acc:1470]
Human Orthologue:
CAMKK2
Human Description:
calcium/calmodulin-dependent protein kinase kinase 2, beta [Source:HGNC Symbol;Acc:1470]
Mouse Orthologue:
Camkk2
Mouse Description:
calcium/calmodulin-dependent protein kinase kinase 2, beta Gene [Source:MGI Symbol;Acc:MGI:2444812]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39321 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114677 Essential Splice Site 178 295 8 11
Genomic Location (Zv9):
Chromosome 21 (position 11566741)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13268016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAATGAATGATATGGAAGCCGGATTTTTGTGGTGTTTTTGTTGTTGCA[G/A]GTGCACCCATGGGTGACGCGACACGGCGCTGAGCCTCTTCCCCCTGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link