si:dkey-174k18.6

Ensembl ID:
ENSDARG00000078643
ZFIN ID:
ZDB-GENE-070912-388
Human Orthologue:
VTCN1
Human Description:
V-set domain containing T cell activation inhibitor 1 [Source:HGNC Symbol;Acc:28873]
Mouse Orthologue:
Vtcn1
Mouse Description:
V-set domain containing T cell activation inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:3039619]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38732 Nonsense Mutation detected in F1 DNA During 2017
sa21461 Nonsense Available for shipment Available now
sa21462 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38732
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109680 Nonsense 6 273 1 5
ENSDART00000142220 Nonsense 6 237 1 4
Genomic Location (Zv9):
Chromosome 9 (position 21553359)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 20709145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACACTTCATAAAAGTAGACCAGCTTACACCAAAATGGCTTCAATTGGA[C/T]AAATAATCTTTGGAAGGTAGAAACATGGGCTACTTACTTCTCTATTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21461
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109680 Nonsense 111 273 3 5
ENSDART00000142220 Nonsense 111 237 3 4
Genomic Location (Zv9):
Chromosome 9 (position 21554549)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 20710335
KASP Assay ID:
2260-1714.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGACACAGAACGCACAGTTCAGCAACAGGGCTCAACTGTTCCCAGACT[C/A]AATTTCAACAGGGAACGCTTCCCTGCTGCTGAGAAACATAAAGCTGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109680 Nonsense 174 273 4 5
ENSDART00000142220 Nonsense 174 237 4 4
Genomic Location (Zv9):
Chromosome 9 (position 21556447)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 20712233
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTTACTGAACTGACCAATGGATCTCTGTCTGCCGTGGCAACTAAATG[G/A]TTTCCTCAGCCAGAGGTGAACTGGTACAATCAAAGTGGGCAGATTTTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link