PLXNA1 (4 of 4)

Ensembl ID:
ENSDARG00000078641
Description:
plexin A1 [Source:HGNC Symbol;Acc:9099]
Human Orthologue:
PLXNA1
Human Description:
plexin A1 [Source:HGNC Symbol;Acc:9099]
Mouse Orthologue:
Plxna1
Mouse Description:
plexin A1 Gene [Source:MGI Symbol;Acc:MGI:107685]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25325 Nonsense Mutation detected in F1 DNA During 2017
sa33787 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111322 Nonsense 230 399 1 2
Genomic Location (Zv9):
Chromosome 6 (position 1532681)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 1477298
KASP Assay ID:
554-7778.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATCCCTTCGGATACGCTGTCCAAATTCCCAGCGTTCGATATCTACTA[T/A]ATTTACAGCTTTAGCAGTGAGCAGTTCGTCTACTACCTGACGTTGCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33787
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111322 Essential Splice Site 385 399 1 2
Genomic Location (Zv9):
Chromosome 6 (position 1532214)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 1476831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCTGGTTGCTCAACAAGGAGCTACCATGCATCAACTCGGTGAGTTCAG[G/A]TCATTGAGACACTGCCTGCCTATGTCGATTGATTTGTTGGGTTTTATGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link